CARD ID | 1964 | |
Type of strain | Gene trap. | |
Strain name | B6.Cg-Mettl2Gt(Ayu21-W15*mERT2)1Card | |
Internal Code | Mettl2-mERT2,156 | |
Submitter | Masatake ARAKI | |
Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Card | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Mettl2 |
Gene name | methyltransferase like 2 |
Allele symbol | |
Allele name | |
MGI | MGI:1289171, |
Chromosome | 11 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Cre-1 | acatgttcagggatcgccag |
Cre-2 | taaccagtgaaacagcattgc |
Disease name, Applicable field | Others |