CARD ID | 3283 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(Myb-74-mhsp68-EGFP) | |
Internal Code | Myb -74 GFP | |
Submitter | Toshio SUDA | |
Submitter affiliation or code | International Research Center for Medical Sciences, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | CSI Singapore, National University of Singapore |
Organization code | ||
Developer | Toshio Suda | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | EGFP |
Gene name | エンハンストGFP |
Allele symbol | |
Allele name | |
MGI | MGI:, |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
Primer1 | aagttcatctgcaccaccg |
Primer2 | tccttgaagaagatggtgcg |
Primer3 | TGTCAGCATTCCAACAAGCC |
Primer4 | AGGAACTAGAGGCTCTGTCC |
Author | Takayoshi Matsumura, Haruhito Totani, Yoshitaka Gunji , Masahiro Fukuda , Rui Yokomori , Jianwen Deng , Malini Rethnam, Chong Yang , Tze King Tan , Tadayoshi Karasawa, Kazuomi Kario, Masafumi Takahashi, Motomi Osato, Takaomi Sanda, Toshio Suda |
Title | A Myb enhancer-guided analysis of basophil and mast cell differentiation |
Journal | Nat Commun |
Volume | 13(1) |
Page | 7064 |
Year | 2022 |
PMID | PMC9674656 " target="_blank" >PMC9674656 |
Disease name, Applicable field | cancer, Immunology, Cell biology, Laboratory-animal Science, Development, Molecular biology |