CARD ID | 1073 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-S1pr2tm1Jch | |
Internal Code | SIP2-Knockout | |
Submitter | ISHII ISAO | |
Submitter affiliation or code | Showa Pharmaceutical University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | Showa Pharmaceutical University |
Organization code | ||
Developer | Isao Ishii | |
Origin (From other organizations) | Organization | The Scripps Research Institute |
Organization code | Jch | |
Developer | Dr. Jerold Chun | |
Year introduced | 2005 / 4 | |
Introduced Generation | N5+F? | |
Remarks |
Gene symbol | S1pr2 (Synonym: Edg5) |
Gene name | Endothelial differentiation, sphingolipid G-protein-coupled receptor,5 |
Allele symbol | S1pr2tm1Jch |
Allele name | targeted mutation 1, Jerold Chun |
MGI | |
Chromosome | 9 (6.0) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
Edg5-1(B2-neo) | GCTAAAGCGCATGCTCCAGACT |
Edg5-2(B2-SA) | ACACCCTTTGTATCAAGTGGCAA |
Author | Imasawa T, Koike K, Ishii I, Chun J, Yatomi Y. |
Title | Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates streptozotocin-induced apoptosis of pancreatic beta-cells. |
Journal | Biochem Biophys Res Commun |
Volume | 392 |
Page | 207-211 |
Year | 2010 |
PMID |
Author | Akahoshi N, Ishizaki Y, Yasuda H, Murashima YL, Shinba T, Goto K, et al. |
Title | Frequent spontaneous seizures followed by spatial working memory/anxiety deficits in mice lacking sphingosine 1-phosphate receptor 2. |
Journal | Epilepsy Behav |
Volume | 22 |
Page | 659-665 |
Year | 2011 |
PMID |
Author | Kitada Y, Kajita K, Taguchi K, Mori I, Yamauchi M, Ikeda T, et al. |
Title | Blockade of sphingosine 1-phosphate receptor 2 signaling attenuates high-fat diet-induced adipocyte hypertrophy and systemic glucose intolerance in mice. |
Journal | Endocrinology |
Volume | 157 |
Page | 1839-1851 |
Year | 2016 |
PMID |
Author | Isao Ishii, Xiaoqin Ye, Beth Friedman, Shuji Kawamura, James J. A. Contos, Marcy A. Kingsbury, Amy H. Yang, Guangfa Zhang, Joan Heller Brown, and Jerold Chun |
Title | Marked Perinatal Lethality and Cellular Signaling Deficits in Mice Null for the Two Sphingosine 1-Phosphate (S1P) Receptors, S1P2/LPB2/EDG-5 and S1P3/LPB3/EDG-3 |
Journal | J. Biol. Chem. |
Volume | 277 |
Page | 25152-25159 |
Year | 2002 |
PMID |
Disease name, Applicable field | Physiology, Development, Immunology, Dermatology, Neurobiology, Metabolism |