CARD R-BASE



Mouse strain


Strain information

CARD ID 1920
Type of strain Gene trap.
Strain name B6.Cg-PkigGt(Ayu21-T354*mERT2)1Card
Internal Code Cre driver Pkig-mERT2,1396
Submitter Masatake ARAKI
Submitter affiliation or code Gene Technology Center, IRDA, Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization IRDA, Kumamoto University
Organization code Card
Developer Masatake Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Pkig
Gene name protein kinase inhibitor, gamma
Allele symbol
Allele name
MGI MGI:1343086,
Chromosome 2 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Cre-1 acatgttcagggatcgccag
Cre-2 taaccagtgaaacagcattgc


Disease , Applicable field information

Disease name, Applicable field Others






Copyright @ 2021 Kumamoto University. All rights reserved.