| CARD ID | 2073 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(CAG-lox-mRFP-lox-GFP)18-43Tama | |
| Internal Code | CAG-lox-mRFP-lox GFP double reporter mouse | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Dept of Morphological Neural Science. Grad Sch of Medical Sciences, Kumamoto Univ. |
| Organization code | Tama | |
| Developer | Nobuaki Tamamaki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | This mice keep homozygote. | |
| Gene symbol | GFP |
| Gene name | Green fluorescent protein |
| Allele symbol | (CAG-lox-mRFP-lox-GFP) |
| Allele name | transgene insertion, Nobuaki Tamamaki, Department of Morphological Brain Science, Graduate School of Medicine, Kyoto University |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| CGGCAAGCTGACCCTGAAG | CTTGTGCCCCAGGATGTTGC |
| Author | Tanahira C, Higo S, Watanabe K, Tomioka R, Ebihara S, Kaneko T, Tamamaki N. |
| Title | Parvalbumin neurons in the forebrain as revealed by parvalbumin-Cre transgenic mice. |
| Journal | Neurosci Res. |
| Volume | Mar;63(3) |
| Page | 213-23 |
| Year | 2009 |
| PMID |
| Disease name, Applicable field | Anatomy, Aging, Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology, Endocrine Disorders, Metabolism, Reproduction, Digestive Disorders, Hematology, Otorhinology, Dentistry, Osteosis, Ophthalomology |