| CARD ID | 2362 | |
| Type of strain | Targeted mutant. | |
| Strain name | C3H/HeJ-Cbstm1Unc | |
| Internal Code | C3H/HeJ-Cbs-knockout | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | ||
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cbs |
| Gene name | cystathionine beta-synthase |
| Allele symbol | Cbstm1Unc |
| Allele name | cystathionine beta-synthase, targeted mutation 1 |
| MGI | MGI:88285, |
| Chromosome | 17 (16.93) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| CBS-KO-1 (Common) | CGGATGACCTGCATTCATCT |
| CBS-KO-2 (WT specific) | GAAGTGGAGCTATCAGAGCA |
| CBS-KO-3 (KO specific) | GAGGTCGACGGTATCGATA |
| Author | Nakano, S., Ishii, I., Shinmura, K., Tamaki, K., Hishiki, T., Akahoshi, N., Ida, T., Nakanishi, T., Kamata, S., Kumagai, Y., Akaike, T., Fukuda, K., Sano, M., Suematsu, M. |
| Title | Hyperhomocysteinemia abrogates fasting-induced cardioprotection against ischemia/reperfusion by limiting bioavailability of hydrogen sulfide anions. |
| Journal | J Mol Med (Berl) |
| Volume | 93 |
| Page | 879-889 |
| Year | 2015 |
| PMID |
| Author | Morikawa, T., Kajimura, M., Nakamura, T., Hishiki, T., Nakanishi, T., Yukutake, Y., Nagahata, Y., Ishikawa, M., Hattori, K., Takenouchi, T., Takahashi, T., Ishii, I., Matsubara, K., Kabe, Y., Uchiyama, S., Nagata, E., Gadalla, M.M., Snyder, S.H., Suematsu, M. |
| Title | Hypoxic regulation of the cerebral microcirculation is mediated by a carbon monoxide-sensitive hydrogen sulfide pathway. |
| Journal | Proc Natl Acad Sci USA |
| Volume | 109 |
| Page | 1293-1298 |
| Year | 2012 |
| PMID |
| Author | Akahoshi, N., Kobayashi, C., Ishizaki, Y., Izumi, T., Himi, T., Suematsu, M., Ishii, I. |
| Title | Genetic background conversion ameliorates semi-lethality and permits behavioral analyses in cystathionine beta-synthase-deficient mice, an animal model for hyperhomocysteinemia. |
| Journal | Hum Mol Genet |
| Volume | 17 |
| Page | 1994-2005 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Physiology, Behavior, Pharmacology, Development, Dermatology, Neurobiology, Metabolism, Digestive Disorders, Hematology, Osteosis |