CARD R-BASE



Mouse strain


Strain information

CARD ID 1814
Type of strain Targeted mutant.
Strain name B6;129-Mll1tm1uc
Internal Code Mlluc
Submitter Yokoyama Akihiko
Submitter affiliation or code Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Stanford University Medical School
Organization code Mlc
Developer Michael L. Cleary
Year introduced 2009 / 5
Introduced Generation
Remarks


Gene information

Gene symbol Mll1
Gene name myeloid/lymphoid or mixed-lineage leukemia 1
Allele symbol
Allele name
MGI
Chromosome 9 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
dC&uc.fwd gttctgaagcacacattccacacc
dC&uc.rev catcaaagcgaagggcaatcagtg


Disease , Applicable field information

Disease name, Applicable field Molecular biology, cancer






Copyright @ 2021 Kumamoto University. All rights reserved.