CARD ID | 762 | |
Type of strain | Targeted mutant. | |
Strain name | B6;CB-B4galt6tm1 | |
Internal Code | none | |
Submitter | Koichi Furukawa | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Nagoya Univ. Sch. of Med. |
Organization code | ||
Developer | Koichi Furukawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | B4galt6 |
Gene name | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 |
Allele symbol | B4galt6tm1 |
Allele name | targeted mutation 1 |
MGI | MGI:1928380, |
Chromosome | 18 (q12) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 604017 Human Gene Symbol: B4GALT6, |
Se1 | GCCTGCTTGCCGAATATCATGGTGGAAAAT |
T6K031 | CCCTCTGCAAGAACAAGAGTTTCACCTCA |
Disease name, Applicable field | Unknown |