CARD ID | 2166 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Ppp3cctm1a(EUCOMM)Osb/12B | |
Internal Code | Ppp3cc KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ppp3cc |
Gene name | protein phosphatase 3, catalytic subunit, gamma isoform |
Allele symbol | Ppp3cctm1(EUCOMM)Osb |
Allele name | protein phosphatase 3, catalytic subunit, gamma isoform, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
MGI | MGI:107162, |
Chromosome | 14 (36.30) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Ppp3cc-both | GAGGCTCCGATCACAGGTATGAA |
Ppp3cc-WT | GGTAGCGAGTATTACTAGGTGATCCC |
LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
Author | Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. |
Title | Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. |
Journal | Science |
Volume | 350(6259) |
Page | 442-5 |
Year | 2015 |
PMID |
Disease name, Applicable field |