| CARD ID | 2822 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Fabp-PLIN) | |
| Internal Code | Perilipin Tg(homo),Perilipin | |
| Submitter | Atsumi Tatsuya | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Hokkaido University |
| Organization code | ||
| Developer | MIKIKO ENDO | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Plin 1 |
| Gene name | Peliripin 1 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| U1-S | 5'GGCCCCCATTGGTCACTCCTAC3' |
| U1-AS | 5'CGCTCTGCACGCCCTTCTCATA3' |
| Author | Masatatsu Yamamoto |
| Title | Abcb10 role in heme biosynthesis in vivo: Abcb10 knockout in mice causes anemia with protoporphyrin IX and iron accumulation |
| Journal | Molecular and Cellular Biology |
| Volume | 34 |
| Page | 1077 |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Obesity, Diabetes, Metabolism |