CARD R-BASE



Mouse strain


Strain information

CARD ID 2495
Type of strain Targeted mutant.
Strain name B6D2-2900092C05Rikem1Osb
Internal Code 2900092C05Rik KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol 2900092C05Rik
Gene name RIKEN cDNA 2900092C05 gene
Allele symbol 2900092C05Rikem1Osb
Allele name RIKEN cDNA 2900092C05 gene, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1920340,
Chromosome 7 (7.53) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
cacgtgtgatgccacaggtgcc
gcaagtaagcctctgggctgtcc


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.