CARD ID | 244 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(0.6hTTRMet30)14Imeg | |
Internal Code | , | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics, Kumamoto Univ. |
Organization code | IMEG | |
Developer | Ken-ichi Yamamura | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ttr |
Gene name | Transthyretin Val30Met(Human) |
Allele symbol | |
Allele name | |
MGI | MGI:98865, |
Chromosome | 13 , |
Gene classification | Gene to express(transgenic) |
Method | |
GO | Gene Ontology |
OMIM | OMIM ID: 176300 Human Gene Symbol: TTR, |
primerA | 5'(TCTCACGTGTCTTCTCTACA)3' |
primerB | 3'(AGCCTCTCTCTACCAAGTGA)5' |
Author | Ken-ichi Yamamura, Shoji Wakasugi, Shuichiro Maeda, Takeaki Inomoto, Tomohisa Iwanaga, Masahiro Uehira, Kimi Araki, Jun-ichi Miyazaki, and Kazunori Shimada |
Title | Tissue-Specific and Developmental Expression of Human Transthyretin Gene in Transgenic Mice |
Journal | Developmental Genetics |
Volume | 8 |
Page | 195-205 |
Year | 1987 |
PMID | 3502973 |
Author | Shoji Wakasugi, Tomohisa Iwanaga, Takeaki Inomoto, Toshimoto Tengan, Shuichiro Maeda, Masahiro Uehira, Kimi Araki, Junichi Miyazaki, Kazuhiro Eto, Kazunori Shimada, and Ken-ichi Yamamura |
Title | An Autosomal Dominant Mutation of Facial Development in a Transgenic Mouse |
Journal | Developmental Genetics |
Volume | 9 |
Page | 203-212 |
Year | 1988 |
PMID | 3409558 |
Author | Hiromitsu Noguchi, Tadashi Kaname, Tomohisa Sekimoto, Kei Senba, Yasushi Nagata, Masatake Araki, Makoto Abe, Naomi Nakagata, Tomomichi Ono, Ken-ichi Yamamura and Kimi Araki |
Title | Naso-maxillary deformity due to frontonasal expression of human transthyretin gene in transgenic mice |
Journal | Genes to Cells |
Volume | 7 |
Page | 1087-1098 |
Year | 2002 |
PMID | 12354101 |
Disease name, Applicable field | Development |