| CARD ID | 3305 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Hhatltm1 | |
| Internal Code | Mg56 | |
| Submitter | Hiroshi Takeshima | |
| Submitter affiliation or code | Kyoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kyoto University |
| Organization code | ||
| Developer | Hiroshi Takeshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hhatl |
| Gene name | hedgehog acyltransferase-like |
| Allele symbol | Hhatltm1 |
| Allele name | hedgehog acyltransferase-like; targeted mutation 1, |
| MGI | MGI:1922020, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Primer1 | gagtggaccagtctcctcagag |
| Primer2 | gctgccaactgtgtctctactc |
| Author | Van B, Nishi M, Komazaki S, Ichimura A, Kakizawa S, Nakanaga K, Aoki J, Park KH, Ma J, Ueyama T, Ogata T, Maruyama N, Takeshima H. |
| Title | Mitsugumin 56 (hedgehog acyltransferase-like) is a sarcoplasmic reticulum-resident protein essential for postnatal muscle maturation |
| Journal | FEBS Letter |
| Volume | 589 |
| Page | 1095-1104 |
| Year | 2015 |
| PMID | 25841338 |
| Disease name, Applicable field |