| CARD ID | 2686 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Kcnj6tm1 | |
| Internal Code | Kcnj6flox/flox | |
| Submitter | Takahama Kazuo | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kumamoto Health Science University |
| Organization code | ||
| Developer | Kazuo Takahama | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Kcnj6 |
| Gene name | potassium inwardly-rectifying channel, subfamily J, member 6 |
| Allele symbol | Kcnj6tm1 |
| Allele name | potassium inwardly-rectifying channel, subfamily J, member 6, targeted mutation 1, |
| MGI | MGI:104781, |
| Chromosome | 16 (55.44) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Kcnj6-Forward | GAGCAGGTACAGAGTGACAG |
| Kcnj6-Reverse | AAGAGTCCAAATGAGATGTTGG |
| Author | Honda I, Araki K, Honda S, Soeda F, Shin MC, Misumi S, Yamamura KI, Takahama K. |
| Title | Deletion of GIRK2 subunit containing GIRK channels of neurons expressing dopamine transporter decrease immobility time on forced swimming in mice |
| Journal | Neuroscience Letters |
| Volume | 665 |
| Page | 140-146 |
| Year | 118 |
| PMID |
| Disease name, Applicable field | Neurobiology |