CARD ID | 2640 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Stra8em1(GFP) | |
Internal Code | Stra8-3FH Ex9 (Lx22-T1bp ins) | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Molecular Embryology and Genetics, Kumamoto University |
Organization code | ||
Developer | Kei-ichiro Ishiguro | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks | This allele was generated by ssODN methods, by injecting Crisp-Cas9 into fertilized egg of Stra8-3xFLAG-HA-2A-GFP genetic background. |
Gene symbol | Stra8 |
Gene name | stimulated by retinoic acid gene 8 |
Allele symbol | Stra8em1(GFP) |
Allele name | stimulated by retinoic acid gene 8, endonuclease-mediated mutation 1, |
MGI | MGI:107917, |
Chromosome | 6 (15.20) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
St8-24996F | AGGCCCAGCATATGTCTAACATCAG |
KI92ES-29564R | AGAAGGCTTTTGGAAGCAGCCTTTC |
Author | Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa |
Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells |
Journal | Developmental Cell |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field | Molecular biology, Development |