CARD R-BASE



Mouse strain


Strain information

CARD ID 1153
Type of strain Targeted mutant.
Strain name STOCK Calrtm1.1Osb
Internal Code calr-tm1
Submitter Masaru Okabe
Submitter affiliation or code Genome Information Research (enter Osaka University)
Stock Type
Material Transfer Conditions Consent to us
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa)
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Research Institute for Microbial Diseases, Osaka University
Organization code Osb
Developer Masahito Ikawa
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Calr
Gene name calreticulin
Allele symbol Calrtm1.1Osb
Allele name calreticulin, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:88252,
Chromosome 8 (41.21) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
2621 gagtggaaaccaggtgaaattgacaacc
2622 cttctctgataagttttcctctgacctc


References

Author Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4.
Title Calreticulin is required for development of the cumulus oocyte complex and female fertility.
Journal Sci Rep.
Volume 5
Page 14254
Year 2015
PMID


Disease , Applicable field information

Disease name, Applicable field Physiology, Development, Immunology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.