CARD ID | 1852 | |
Type of strain | Targeted mutant. | |
Strain name | B6;CB-Ptf1atm1(EGFP)Card | |
Internal Code | Ptf1a-EGFP knockin mouse | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto University |
Organization code | Card | |
Developer | Ken-ichi Yamamura | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ptf1a |
Gene name | pancreas specific transcription factor 1a |
Allele symbol | Ptf1atm1(EGFP)Card |
Allele name | pancreas specific transcription factor, 1a; targeted mutation 1, Center for Animal Resources and Development |
MGI | MGI:1328312, |
Chromosome | 2 (13.37) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Ptf1a-ex1-s1 | agc tcc agc aag cgg gta cta t |
SP-A | cagtgtatatcattgtaacc |
Disease name, Applicable field | Laboratory-animal Science, Diabetes, Endocrine Disorders, Metabolism |