| CARD ID | 2253 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Choptm1 | |
| Internal Code | Chop KO | |
| Submitter | Oike Yuich | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Osaka University |
| Organization code | ||
| Developer | Shizuo Akira | |
| Year introduced | 2000 / 4 | |
| Introduced Generation | 20 | |
| Remarks | ||
| Gene symbol | Ddit3 |
| Gene name | DNA-damage inducible transcript 3 |
| Allele symbol | Ddit3tm1 |
| Allele name | DNA-damage inducible transcript 3, targeted mutation 1, |
| MGI | MGI:109247, |
| Chromosome | 10 (74.50) (10 D3) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| sCHOP1 | cctggattaagcttggtagt |
| aCHOP5 | ggacgcagggtcaagagtag |
| neo-F | agaggctattcggctatgac |
| neo-R | gcttgccgaatatcatggtg |
| Author | Y. Miyazaki, K. Kaikita, M. Endo, E. Horio, M. Miura, K. Tsujita, S. Hokimoto, M. Yamamoto, T. Iwawaki, T. Gotoh, H. Ogawa & Y. Oike. |
| Title | C/EBP homologous protein deficiency attenuates myocardial reperfusion injury by inhibiting myocardial apoptosis and inflammation. |
| Journal | Arterioscler. Thromb. Vasc. Biol., |
| Volume | 31 |
| Page | 1124-1132 |
| Year | 2011 |
| PMID |
| Author | H. Tsukano, T. Gotoh*, M. Endo, K. Miyata, H. Tazume, T. Kadomatsu, M. Yano, T. Iwawaki, K. Kohno, K. Araki, H. Mizuta & Y. Oike. |
| Title | The Endoplasmic Reticulum Stress-CHOP Pathway-mediated Apoptosis in Macrophages Contributes to the Instability of Atherosclerotic Plaques. |
| Journal | Arterioscler. Thromb. Vasc. Biol., |
| Volume | 30 |
| Page | 1925-1932 |
| Year | 2010 |
| PMID |
| Author | S. Oyadomari, A. Koizumi, K. Takeda, T. Gotoh, S. Akira, E. Araki & M. Mori. |
| Title | A targeted disruption of the CHOP gene protects mice against ER stress-induced diabetes. |
| Journal | J. Clin. Invest. |
| Volume | 109 |
| Page | 525-532 |
| Year | 2002 |
| PMID |
| Disease name, Applicable field | Cell biology, Diabetes, infectious, Neurobiology, Metabolism, Hematology |