| CARD ID | 2537 | |
| Type of strain | Transgenic. | |
| Strain name | B6.Cg-Tg(CAG-flpo)1Osb | |
| Internal Code | C57BL/6(CAG-FLPo)#1 | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | FLPo |
| Gene name | FLPo |
| Allele symbol | Tg(CAG-flpo)1Osb |
| Allele name | transgene insertion 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| 750 | GCAACGTGCTGGTTGTTGTGCTGTCTCATC |
| 5867 | TCAGATCCGCCTGTTGATGTAGCTG |
| Author | Yamazaki D, Miyata H, Funato Y, Fujihara Y, Ikawa M, Miki H. |
| Title | The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction. |
| Journal | J Cell Sci. |
| Volume | 129(9) |
| Page | 1940-9 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |