CARD ID | 558 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129Sv-V1btm1 | |
Internal Code | V1b knockout mouse, B6;129Sv-V1btm1 | |
Submitter | Nakamura Kazuaki | |
Submitter affiliation or code | National Research Institute for Child Health and Development | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | National Center for Child Health and Development Resarch Institute Dept. |
Organization code | ||
Developer | Tanoue Akito | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Avpr1b |
Gene name | arginine vasopressin receptor 1B |
Allele symbol | V1btm1 |
Allele name | targeted mutation 1 |
MGI | MGI:1347010, |
Chromosome | 1 , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Neo 159 | GTCCGGTGCCCTGAATGAACTGCAA |
Neo 706C | ATTCGCCGCCAAGCTCTTCAG |
Author | Akito Tanoue, Shuji Ito, Kenji Honda, Sayuri Oshikawa, Yoko Kitagawa, Taka-aki Koshimizu, Toyoki Mori, and Gozoh Tsujimoto |
Title | The vasopressin V1b receptor critically regulates hypothalamic-pituitary-adrenal axis activity under both stress and resting conditions |
Journal | The Journal of Clinical Investigation |
Volume | 113 |
Page | 302-309 |
Year | 2004 |
PMID |
Disease name, Applicable field | Physiology |