CARD ID | 1230 | |
Type of strain | Transgenic. | |
Strain name | B6N;B6J-Tg(AP2-Angptl2)3 | |
Internal Code | aP2-Angptl2 Line3 | |
Submitter | Oike Yuich | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Angptl2 |
Gene name | angiopoietin-like2 |
Allele symbol | Tg(AP2-Angptl2)3 |
Allele name | transgene insertion 3 |
MGI | MGI:1347002, |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
Primer-1 | acttctacatgagatcattc |
Primer-2 | ggtattctcaggcttcaccaggta |
Disease name, Applicable field | Metabolism |