| CARD ID | 2775 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-4930432K21Rikem1 | |
| Internal Code | 4930432K21Rik- Line #11 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | 4930432K21Rik |
| Gene name | RIKEN cDNA 4930432K21 gene |
| Allele symbol | 4930432K21Rikem1 |
| Allele name | RIKEN cDNA 4930432K21 gene; endonuclease-mediated mutation 1, |
| MGI | MGI:1921916, |
| Chromosome | 8 (40.35) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 4930432K21Rik-1F | TGTTCACACAAAGTTCTTGAATCAG |
| 4930432K21Rik-3R | TCTGTGTGAGAATTGAGGCCTAAGC |
| 4930432K21Rik-2R | GAGGTAAAGGGTTTGAGTTCAGACC |
| Author | Kazumasa Takemoto, Naoki Tani, Yuki Takada-Horisawa, Sayoko Fujimura, Nobuhiro Tanno, Mariko Yamane, Kaho Okamura, Michihiko Sugimoto, Kimi Araki, Kei-ichiro Ishiguro. |
| Title | A meiosis-specific factor C19orf57/4930432K21Rik/BRME1 modulates localization of RAD51 and DMC1 recombinases to DSBs in mouse meiotic recombination. |
| Journal | Cell Reports |
| Volume | |
| Page | |
| Year | 2020.02.14 |
| PMID |
| Disease name, Applicable field | Cell biology, Reproduction |