CARD ID | 1790 | |
Type of strain | Targeted mutant. | |
Strain name | Alk2-flox | |
Internal Code | Alk2-flox mouse | |
Submitter | Esumi Shigeyuki | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
You need MTA with Michigan Univ. |
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | University of Michigan |
Organization code | ||
Developer | Vesa Kaartinen | |
Year introduced | 2011 / 4 | |
Introduced Generation | ||
Remarks | Need MTA with University of Michigan |
Gene symbol | Acvr1 (synonymous to Alk2) |
Gene name | Activin receptor type 1 |
Allele symbol | Alk2tm1 |
Allele name | Activin receptor type 1; targeted mutation 1 |
MGI | |
Chromosome | 2 (33.05) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Alk2I7F (Alk2-Intron7-Forward) | CCCCCATTGAAGGTTTAGAGAGAC |
Alk2I7R2 (Alk2-Intron7-Reverse2) | CTAAGAGCCATGACAGAGGTTG |
Disease name, Applicable field | Development, Urology, Neurobiology, Digestive Disorders, Hematology, Osteosis |