CARD R-BASE



Mouse strain


Strain information

CARD ID 2582
Type of strain Targeted mutant.
Strain name B6D2-Plcz1em3(D210R)Osb
Internal Code Plcz1 point mutation (D210R)
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Plcz1
Gene name phospholipase C, zeta 1
Allele symbol Plcz1em3(D210R)Osb
Allele name phospholipase C, zeta 1, endonuclease-mediated mutation 3, Research Institute for Microbial Diseases, Osaka University
MGI MGI:2150308,
Chromosome 6 (69.77) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Fw ATGACTAGGGAGGAGCAGAGAC
Rv ATTCCCATGACCACTCACTACC


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.