| CARD ID | 708 | |
| Type of strain | Transgenic. | |
| Strain name | B6;C3H-Tg(RIP-Ptgs2/RIP-Ptges) | |
| Internal Code | B6;C3H-Tg(RIP-Ptgs2/RIP-Ptges), RIP-C2mE | |
| Submitter | Masanobu Oshima | |
| Submitter affiliation or code | Division of Genetics, Cancer Research Institute, Kanazawa University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Research Institute, Kanazawa University |
| Organization code | ||
| Developer | Hiroko Oshima | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ptges (synonym:PmGES-1) |
| Gene name | Ptges:prostaglandin E synthase |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1927593, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM | OMIM ID: 600262 Human Gene Symbol: PTGS2, OMIM ID: 605172 Human Gene Symbol: PTGES, |
| Gene symbol | Ptgs2 (synonym:COX-2) |
| Gene name | prostaglandin-endoperoxide synthase 2 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:97798, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| COX-2-F3 | CAAACTCAAGTTTGACCCAG |
| COX-2-R1 | CTTTTACAGCTCAGTTGAACG |
| Author | Hiroko Oshima, Makoto Mark Taketo, and Masanobu Oshima |
| Title | Destruction of Pancreatic β-Cells by Transgenic Induction of Prostaglandin E2 in the Islets |
| Journal | J. Biol. Chem. |
| Volume | 281 |
| Page | 29330-29336 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | Unknown, Physiology, Metabolism |