CARD ID | 2163 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Lypd4tm1Osb/4E | |
Internal Code | Lypd4 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | ||
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Lypd4 |
Gene name | Ly6/Plaur domain containing 4 |
Allele symbol | Lypd4tm1Osb/ |
Allele name | Ly6/Plaur domain containing 4; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:2687054, |
Chromosome | 7 (13.30) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
#6156 | CTAGGGATTACTGGCAAGAACGGGG |
#6157 | GGGTTGACTGGCCTTGAGTCTCAC |
Disease name, Applicable field |