| CARD ID | 369 | |
| Type of strain | Targeted mutant. | |
| Strain name | ICR;129-Hprttm1 | |
| Internal Code | HPRT KO, ICR;129-Hprttm1 | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Hitoshi Niwa |
| Organization code | ||
| Developer | Department of Nutrition and Physiological chemistry, Osaka Unv. Med. Sch. | |
| Year introduced | 1999 / 3 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hprt |
| Gene name | Hypoxanthine guanine phosphoribosyl transferase |
| Allele symbol | Hprttm1 |
| Allele name | Hprt, targetedd mutation 1 |
| MGI | MGI:96217, |
| Chromosome | X (16.03-17.97 cM) (XA4, XA5 band) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Other |
| OMIM |
| primerA | 5'(gcagattagcgatgatgaacc)3' |
| primerB | 5'(cctgtccataatcagtccatga)3' |
| Author | Martin Hooper, Kate Hardy, Alan Handyside, Susan Hunter & Marilyn Monk |
| Title | HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells |
| Journal | NATURE |
| Volume | 326 |
| Page | 292-295 |
| Year | 1987 |
| PMID | 3821905 |
| Author | Simon Thompson, Alan R. Clarke, Angela M. Pow, Martin L. Hooper, and David W. Melton |
| Title | Germ Line Transmission and Expression of a Corrected HPRT Gene Produced by Gene Targeting in Embryonic Stem Cells |
| Journal | Cell |
| Volume | 56 |
| Page | 313-321 |
| Year | 1989 |
| PMID | 2912572 |
| Disease name, Applicable field |