CARD ID | 2626 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6- Gm4969 em2 | |
Internal Code | StIP1Ex1 KO | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gm4969(StIP1) |
Gene name | predicted gene 4969 |
Allele symbol | Gm4969 em2 |
Allele name | predicted gene 4969, endonuclease-mediated mutation 2, |
MGI | MGI:3647482, |
Chromosome | 7 (9.46) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Gm4969-13926F | GTCCTATTTTAGGAACTCTAGGTGC |
Gm4969-14285R | GAAATGAAGGACTATACGCACCTAC |
Disease name, Applicable field | Cell biology, Reproduction |