CARD ID | 2251 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6-Tg(CAG-LSL-p62)139Card | |
Internal Code | CAG promoter-LSL-p62 line 139 | |
Submitter | Ohmuraya Masaki | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto University |
Organization code | Card | |
Developer | Masaki Ohmuraya | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Sqstm1 |
Gene name | sequestosome 1 |
Allele symbol | |
Allele name | |
MGI | MGI:107931, |
Chromosome | |
Gene classification | Gene to express(transgenic) |
Method | electroporation |
OMIM |
p62-F2 | gctgccctatacccacatct |
Ag4 | accaccttctgataggcag |
Disease name, Applicable field | Laboratory-animal Science, cancer, Digestive Disorders, Osteosis |