CARD ID | 2154 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Adam3tm1(KOMP)Osb/11B | |
Internal Code | Adam3 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Adam3 |
Gene name | a disintegrin and metallopeptidase domain 3 |
Allele symbol | Adam3tm1(KOMP)Osb |
Allele name | a disintegrin and metallopeptidase domain 3 , targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:102518, |
Chromosome | 8 (13.09) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#5319 | ATCCGGGGGTACCGCGTCGAG |
#6042 | ACAGCTCACTCCATTGCATTTGCC |
#6043 | CTGGTTAGCACACAAGCAAAGGGG |
Author | Fujihara Y, Oji A, Kojima-Kita K, Larasati T, Ikawa M. |
Title | Co-expression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice. |
Journal | J Cell Sci |
Volume | 2018 Oct 8;131(19) |
Page | pii: jcs221481. doi: 10.1242/jcs.221481. |
Year | 2018 |
PMID |
Disease name, Applicable field |