| CARD ID | 2855 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gpr120em1 | |
| Internal Code | GPR120KO | |
| Submitter | Kimura Ikuo | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology |
| Organization code | ||
| Developer | Ikuo Kimura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gpr120 |
| Gene name | G protein-coupled receptor 120 |
| Allele symbol | Gpr120em1 |
| Allele name | G protein-coupled receptor 120, endonuclease-mediated mutation 1, |
| MGI | MGI:2147577, |
| Chromosome | 19 (32.73) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Gpr120-PCR-F1 | CTTTAATTTTCTGGCTTAAGAGCAC |
| Gpr120-PCR-R1 | CCCTTAACACTTGTGAGGATTTACT |
| Author | Miyamoto J, Igarashi M, Watanabe K, Karaki SI, Mukouyama H, Kishino S, Li X, Ichimura A, Irie J, Sugimoto Y, Mizutani T, Sugawara T, Miki T, Ogawa J, Drucker DJ, Arita M, Itoh H, Kimura I. |
| Title | Gut microbiota confers host resistance to obesity by metabolizing dietary polyunsaturated fatty acids. |
| Journal | Nat Commun. |
| Volume | 10 |
| Page | 4007 |
| Year | 2019 |
| PMID |
| Disease name, Applicable field |