| CARD ID | 2532 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Tcte1em1(Tcte1-Flag)Osb | |
| Internal Code | Tcte1-FLAG KI | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Tcte1 |
| Gene name | t-complex-associated testis expressed 1 |
| Allele symbol | Tcte1em1(Tcte1-Flag)Osb |
| Allele name | t-complex-associated testis expressed 1; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:98640, |
| Chromosome | 17 (22.54) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| F03 | CTAGACCGACTATTCTCAGG |
| R01 | TGTACAAGCAGACAACGTCAGG |
| Author | Castaneda JM, Hua R, Miyata H, Oji A, Guo Y, Cheng Y, Zhou T, Guo X, Cui Y, Shen B, Wang Z, Hu Z, Zhou Z, Sha J, Prunskaite-Hyyrylainen R, Yu Z, Ramirez-Solis R, Ikawa M, Matzuk MM, Liu M |
| Title | TCTE1 is a conserved component of the dynein regulatory complex and is required for motility and metabolism in mouse spermatozoa |
| Journal | Proc Natl Acad Sci |
| Volume | 114 (27) |
| Page | 5370-5378 |
| Year | 2017 |
| PMID |
| Disease name, Applicable field |