CARD R-BASE



Mouse strain


Strain information

CARD ID 379
Type of strain Targeted mutant.
Strain name STS.B6CB-Trp53tm1Sia
Internal Code STS/A-p53+/KO, STS.B6CB-Trp53tm1Sia
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions No condition
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Shiro Aizawa
Organization code
Developer National Institute of Radiological Sciences
Year introduced 2001 / 9
Introduced Generation N17
Remarks


Gene information

Gene symbol Trp53
Gene name Transformation related protein 53
Allele symbol Trp53tm1Sia
Allele name Trp53, targeted mutation 1, Shinichi Aizawa
MGI MGI:98834,
Chromosome 11 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
GO Gene Ontology
OMIM OMIM ID: 191170 Human Gene Symbol: TP53,

PCR Primer 1
primerA 5'(aattgacaagttatgcatccatacagtaaca)3'
primerB 5'(actcctcaacatcctggggcagcaacagat)3'


References

Author M Okumoto, R Nishikawa, S Imai and J Hilgers
Title Genetic analysis of resistance to radiation lymphomagenesis with recombinant inbred strains of mice
Journal Cancer Research
Volume 50
Page 3848-3850
Year 1990
PMID 2354437
Author Okumoto M, Nishikawa R, Imai S, Hilgers J.
Title Resistance of STS/A mice to lymphoma induction by X-irradiation.
Journal J Radiat Res (Tokyo)
Volume 30
Page 135-139
Year 1989
PMID 2769623


Disease , Applicable field information

Disease name, Applicable field cancer






Copyright @ 2021 Kumamoto University. All rights reserved.