| CARD ID | 2415 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL6N-Il1f6em1 | |
| Internal Code | Il1f6-KO | |
| Submitter | Inaba Mutsumi | |
| Submitter affiliation or code | Graduate School of Veterinary Medicine, Hokkaido University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Hokkaido University |
| Organization code | ||
| Developer | Osamu Ichii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Il1f6 |
| Gene name | Interleukin 1 family member 6 |
| Allele symbol | Il1f6em1 |
| Allele name | Interleukin 1 family member 6, endonuclease-mediated mutation 1, |
| MGI | MGI:1859324, |
| Chromosome | 2 (16.26) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Other |
| OMIM |
| F | AGGTTAGAAACGCAGCCTGT |
| R | TCTAAACTCACCCCAAGCTGTAG |
| Disease name, Applicable field | Unknown, Immunology, cancer |