CARD ID | 2075 | |
Type of strain | Inbred., Spontaneous/Chemical induced mutant. | |
Strain name | C57BL/6-Sh2d1arpl | |
Internal Code | C57BL/6.sap-/sap- | |
Submitter | Ono Masao | |
Submitter affiliation or code | Department of Pathology, Tohoku University Graduate School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
No condition
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Tohoku University Graduate School of Medicine |
Organization code | ||
Developer | Masao Ono | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Sh2d1a |
Gene name | SH2 domain containing 1A |
Allele symbol | |
Allele name | |
MGI | MGI:1328352, |
Chromosome | X (23.20) , |
Gene classification | Other gene(mutant etc.) |
Method | |
OMIM |
Gene symbol | |
Gene name | |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | |
Gene classification | Other gene(mutant etc.) |
Method | |
OMIM |
mSAP-1 | GAGAAGCTCTTACTCGGTA |
mSAP-2 | CCACTACCACGAGATATACT |
Author | Hiroaki Komori, Hiroshi Furukawa, Shiro Mori, Mitsuko R. Ito, Miho Terada, |
Title | A Signal Adaptor SLAM-Associated Protein Regulates |
Journal | J Immunol |
Volume | 176 |
Page | 395–400 |
Year | 2006 |
PMID |
Disease name, Applicable field | Laboratory-animal Science, Genetics |