| CARD ID | 1520 | |
| Type of strain | Transgenic. | |
| Strain name | B6;(BDF1)-Tg(MCMe1-LacZ)041Ham | |
| Internal Code | e1pro | |
| Submitter | Kato Hideki | |
| Submitter affiliation or code | Hamamtsu | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Pathology , Hamamatu University School of Medicine |
| Organization code | Ham | |
| Developer | Yoshifumi Arai | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | LacZ |
| Gene name | beta-galactosidase |
| Allele symbol | Tg(MCMe1-LacZ)041Ham |
| Allele name | transgene insertion 041 Hamamatsu University School of Medicine |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| 5e1F3 | CGGGGTACCCGAGGAGCGCCACTAGGTTG |
| 5e1R | ATAGAAGCTTTGGTCTGCTAAATGCGAAGATCG |
| Author | B Bühler, G M Keil, F Weiland, and U H Koszinowski |
| Title | Characterization of the murine cytomegalovirus early transcription unit e1 that is induced by immediate-early proteins. |
| Journal | J. Virol |
| Volume | 64(5) |
| Page | 1907-1919 |
| Year | 1990 |
| PMID |
| Author | Yoshifumi Arai, Mizuho Ishiwata, Satoshi Baba, Hideya Kawasaki, Isao Kosugi, Ren-Yong Li, Takashi Tsuchida, Katsutoshi Miura, and Yoshihiro Tsutsui |
| Title | Neuron-Specific Activation of Murine Cytomegalovirus Early Gene e1 Promoter in Transgenic Mice |
| Journal | Am J Pathol |
| Volume | 163(2) |
| Page | 643-652 |
| Year | 2003 |
| PMID |
| Disease name, Applicable field | Development |