CARD ID | 555 | |
Type of strain | Targeted mutant. | |
Strain name | B6.CBA-Ahctf1tm2 | |
Internal Code | , B6.CBA-Ahctf1tm2 | |
Submitter | Unknown Unknown | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Kumamoto University |
Organization code | Unknown | |
Developer | Keisuke Okita | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ahctf1(old symbol:Elys) |
Gene name | AT hook containing transciption factor 1 |
Allele symbol | Ahctf1tm2 |
Allele name | targeted mutation 2 |
MGI | |
Chromosome | 1 (102) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM | OMIM ID: 610853 Human Gene Symbol: AHCTF1, |
Neo Seq R | CTTCCTCGTGCTTTACGGTA |
KOP2g6F | ACCACTTTATTCCATGTCCAC |
Author | Keisuke Okita, Hiroshi Kiyonari, Ikuo Nobuhisa, Naoki Kimura, Shinichi Aizawa and Tetsuya Taga |
Title | Targeted disruption of the mouse ELYS gene results in embryonic death at peri-implantation development |
Journal | Genes to Cells |
Volume | 9 |
Page | 1083-1091 |
Year | 2004 |
PMID | 15507119 |
Disease name, Applicable field | Development |