CARD R-BASE



Mouse strain


Strain information

CARD ID 2138
Type of strain Targeted mutant.
Strain name B6;BDF1-Oosp1tm1a(KOMP)Osb/30
Internal Code Oosp1 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Oosp1
Gene name oocyte secreted protein 1
Allele symbol Oosp1tm1a(KOMP)Osb/30
Allele name oocyte secreted protein 1; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University
MGI MGI:2149290,
Chromosome 19 (8.48) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
#5083 actgatggcgagctcagacc
#5436 taaggatcaggcctacgata
PCR Primer 2
#5759 gtgccgaccactggttccatc
#5760 gcactgttacagcacagcctctc


References

Author Ferheen Abbasi, Mayo Kodani, Chihiro Emori, Daiji Kiyozumi, Masashi Mori, Yoshitaka Fujihara, Masahito Ikawa.
Title CRISPR/Cas9-Mediated Genome Editing Reveals Oosp Family Genes are Dispensable for Female Fertility in Mice.
Journal Cells
Volume 9(4)
Page
Year 2020
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.