| CARD ID | 2130 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | B6D2-Calr3tm1Osb Tg(Calr3-Calr3)Osb | |
| Internal Code | Calr3 TG | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Calr3 |
| Gene name | calreticulin 3 |
| Allele symbol | Calr3tm1Osb |
| Allele name | calreticulin 3; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1920566, |
| Chromosome | 8 (35.08) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Calr3 |
| Gene name | calreticulin 3 |
| Allele symbol | Tg(Calr3-Calr3)Osb |
| Allele name | calreticulin 3; transgene insertion, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1920566, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| 1177 | TTCTGGTCCAGGTCAGACGG |
| 1402 | ctatcgattcccgtcggccaccgcgctc |
| Author | Ikawa M, Tokuhiro K, Yamaguchi R, Benham AM, Tamura T, Wada I, Satouh Y, Inoue N, Okabe M. |
| Title | Calsperin is a testis-specific chaperone required for sperm fertility |
| Journal | J Biol Chem |
| Volume | 286(7) |
| Page | 5639-46 |
| Year | 2011 |
| PMID |
| Disease name, Applicable field |