| CARD ID | 2378 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Triml1tm1Miya | |
| Internal Code | Triml1 KO | |
| Submitter | Miyazaki Jun-ichi | |
| Submitter affiliation or code | Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Miya | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Triml1 |
| Gene name | tripartite motif family-like 1 |
| Allele symbol | Triml1tm1Miya |
| Allele name | tripartite motif family-like 1, targeted mutation 1, |
| MGI | MGI:2687279, |
| Chromosome | 8 (23.89) (8A4) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Cue320-seq3-F | AGTGTCAATTCATTGTGCGTC |
| Cue320-WT-allele-R | TCTACCCTGAGCATCTGAGAGACTC |
| Disease name, Applicable field | Development, Reproduction |