| CARD ID | 2609 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2;B6-Plcz1em1Osb | |
| Internal Code | Plcz1 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Plcz1 |
| Gene name | phospholipase C, zeta 1 |
| Allele symbol | Plcz1em1Osb |
| Allele name | phospholipase C, zeta 1 , endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:2150308, |
| Chromosome | 6 (69.77) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Plcz1-210-F | ATGACTAGGGAGGAGCAGAGAC |
| Plcz-210-R | ATTCCCATGACCACTCACTACC |
| Plcz1-N-F | GACCACATCTTTCATGTCC |
| Plcz1-C-R | AGCAACTGAGAATGCAACCC |
| Author | Kaori Nozawa, Yuhkoh Satouh, Takao Fujimoto, Asami Oji, Masahito Ikawa |
| Title | Sperm-borne phospholipase C zeta-1 ensures monospermic fertilization in mice |
| Journal | Scientific Reports |
| Volume | 8 |
| Page | 1315 |
| Year | 2018 |
| PMID |
| Disease name, Applicable field |