CARD ID | 2399 | |
Type of strain | Targeted mutant. | |
Strain name | B6;129-ROSA26tm1(tTA-isl1-EGFP)Miya | |
Internal Code | RTFN-Isl1-EGFP | |
Submitter | Miyazaki Satsuki | |
Submitter affiliation or code | Division of Stem Cell Regulation Research Osaka University Graduate School of Medicine | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Miya | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | ROSA26 locus |
Gene name | ROSA26 locus |
Allele symbol | ROSA26tm1(tTA-isl1-EGFP)Miya |
Allele name | |
MGI | |
Chromosome | 6 (52.73) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
TetO-S1 | TCCACGCTGTTTTGACCTCC |
Isl1-R1 | ACACAGCGGAAACACTCGATG |
Author | Miyazaki S, Tashiro F, Fujikura J, Yamato E, Miyazaki J |
Title | Acinar-to-ductal metaplasia induced by adenovirus-mediated pancreatic expression of Isl1. |
Journal | PLoS One |
Volume | 7 |
Page | e47536 |
Year | 2012 |
PMID |
Disease name, Applicable field | Diabetes |