CARD R-BASE



Mouse strain


Strain information

CARD ID 2155
Type of strain Targeted mutant.
Strain name C57BL/6-Pate4tm1(KOMP)Osb3A
Internal Code Pate4 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Pate4
Gene name prostate and testis expressed 4
Allele symbol Pate4tm1(KOMP)Osb3A
Allele name prostate and testis expressed 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1930790,
Chromosome 9 (20.34) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
#5319 ATCCGGGGGTACCGCGTCGAG
#5897 GGTAAGTGGGGCTGATACAGACTCC
PCR Primer 2
#5898 CCTTGCACTGAGGCGAGCAC


References

Author Noda T, Fujihara Y, Matsumura T, Oura S, Kobayashi S, Ikawa M.
Title Seminal vesicle secretory protein 7, PATE4, is not required for sperm function but for copulatory plug formation to ensure fecundity.
Journal Biol Reprod.
Volume 100(4)
Page 1035-1045
Year 2019 Apr 19
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.