| CARD ID | 1979 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.Cg-Atpif1tm1 | |
| Internal Code | Atpif1 KO | |
| Submitter | Masasuke Yoshida | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Others
1;In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (will be announced). 2;Within a period of 3 years after deposition of the material, user must contact bailor and notify him a content of the research. If the bailor judges that the research should be a collaborative work, then user must include bailor and/or developer's names as co-authors. |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Molecular Bioscience, Kyoto Sangyo University |
| Organization code | ||
| Developer | Yoshida Masasuke | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Atpif1 |
| Gene name | ATPase inhibitory factor 1 |
| Allele symbol | Atpif1tm1 |
| Allele name | ATPase inhibitory factor 1, targeted mutation 1, Masasuke Yoshida, Kyoto Sangyo University |
| MGI | |
| Chromosome | 4 (65.51 ) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Atpif1-For1 | GTGCATGTGCACTTTTGTGTGTGTGTATGC |
| Atpif1-Rev1 | ACACAGCAGCTCACAAGCACATGTAACTGC |
| Disease name, Applicable field | Unknown, cancer, Metabolism |