CARD ID | 3380 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Or51e1em1 | |
Internal Code | Gpr164KO | |
Submitter | Kimura Ikuo | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Or51e1 |
Gene name | olfactory receptor family 51 subfamily E member 1 |
Allele symbol | Or51e1em1 |
Allele name | olfactory receptor family 51 subfamily E member 1; endonuclease-mediated mutation 1, |
MGI | MGI:3030392, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
GPR164_F1 | AGGGTTCAGGATAAAATTACAGTCA |
GPR164_R1 | CCAATTCTAACTTCTCAGAAATCCA |
Disease name, Applicable field | Unknown |