| CARD ID | 2680 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-B230118H07Riktm2 | |
| Internal Code | C11orf74 KO 9bp ing | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Dept cell Biol,Grad Sch of Med, Osaka Univ. |
| Organization code | ||
| Developer | Akihiro Harada | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | B230118H07Rik |
| Gene name | RIKEN cDNA B230118H07 gene |
| Allele symbol | B230118H07Riktm2 |
| Allele name | RIKEN cDNA B230118H07 gene, targeted mutation 2, |
| MGI | MGI:1915420, |
| Chromosome | 2 (53.83) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| mC11ORF74-genome-FW | GGGTGCCCTTTGAGATTTTCC |
| mC11ORF74-genome-RV | AAAGGCATAGGTGTCCATACC |
| Disease name, Applicable field | Unknown |