| CARD ID | 3261 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Hlfem1 | |
| Internal Code | Hlf-tdTomato | |
| Submitter | Tomomasa Yokomizo | |
| Submitter affiliation or code | Tokyo Women’s Medical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hlf |
| Gene name | hepatic leukemia factor |
| Allele symbol | Hlfem1 |
| Allele name | hepatic leukemia factor; endonuclease-mediated mutation 1, |
| MGI | MGI:96108, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| NW180 | caggaggtggctgatttaag |
| NW197 | tagttgccagccatctgttg |
| NW333 | tcccattctgagatacaccagtg |
| Author | Yokomizo T, Watanabe N, Umemoto T, Matsuo J, Harai R, Kihara Y, Nakamura E, Tada N, Sato T, Takaku T, Shimono A, Takizawa H, Nakagata N, Mori S, Kurokawa M, Tenen DG, Osato M, Suda T, Komatsu N |
| Title | Hlf marks the developmental pathway for hematopoietic stem cells but not for erythro-myeloid progenitors |
| Journal | J Exp Med |
| Volume | 216(7) |
| Page | 1599-1614 |
| Year | 2019 |
| PMID | 31076455 |
| Disease name, Applicable field | cancer, infectious, Immunology, Cell biology, Laboratory-animal Science, Development |