CARD ID | 2138 | |
Type of strain | Targeted mutant. | |
Strain name | B6;BDF1-Oosp1tm1a(KOMP)Osb/30 | |
Internal Code | Oosp1 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Oosp1 |
Gene name | oocyte secreted protein 1 |
Allele symbol | Oosp1tm1a(KOMP)Osb/30 |
Allele name | oocyte secreted protein 1; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:2149290, |
Chromosome | 19 (8.48) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
#5083 | actgatggcgagctcagacc |
#5436 | taaggatcaggcctacgata |
#5759 | gtgccgaccactggttccatc |
#5760 | gcactgttacagcacagcctctc |
Author | Ferheen Abbasi, Mayo Kodani, Chihiro Emori, Daiji Kiyozumi, Masashi Mori, Yoshitaka Fujihara, Masahito Ikawa. |
Title | CRISPR/Cas9-Mediated Genome Editing Reveals Oosp Family Genes are Dispensable for Female Fertility in Mice. |
Journal | Cells |
Volume | 9(4) |
Page | |
Year | 2020 |
PMID |
Disease name, Applicable field | Development |