CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 763
Type of strain Targeted mutant.
Strain name B6;CB-B4galt6tm2
Internal Code none
Submitter Koichi Furukawa
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Nagoya Univ. Sch. of Med.
Organization code
Developer Koichi Furukawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol B4galt6
Gene name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 current symbol: B4galt6
Allele symbol
Allele name
MGI MGI:1928380,
Chromosome 18 (q12) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM OMIM ID: 604017 Human Gene Symbol: B4GALT6,

PCR Primer 1
Se1 GCCTGCTTGCCGAATATCATGGTGGAAAAT
T6K031 CCCTCTGCAAGAACAAGAGTTTCACCTCA


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.