CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 653
Type of strain Targeted mutant.
Strain name B6;129-Stxbp3tm1
Internal Code
Submitter KANDA Hajime
Submitter affiliation or code Kobe University School of Medicine
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization Kobe University Graduate School of Medicine
Organization code
Developer Shinoda Akihiro
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol stxbp3
Gene name stxbp3(syntaxin binding protein 3)
Allele symbol
Allele name
MGI
Chromosome 3 , 3 , 3 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM OMIM ID: 608339 Human Gene Symbol: STXBP3,

PCR Primer 1
TCGTGCTTTACGGTATCGCCGCTCCCGATT
TGGCAGACCTAGGTTTGGTGTC


References

Author
Title
Journal
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field Development, Neurobiology, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.